Stem-loop sequence dre-mir-365-3

AccessionMI0002070 (change log)
DescriptionDanio rerio miR-365-3 stem-loop
Gene family MIPF0000061; mir-365
Literature search

2 open access papers mention dre-mir-365-3
(3 sentences)

Stem-loop
   ----aaguca      aa        ac           -----    u   a 
5'           gcaaga  agugaggg  uuuuaggggca     gcug guu u
             ||||||  ||||||||  |||||||||||     |||| ||| a
3'           cguucu  uuauuccu  aaaauccccgu     ugac cag c
   caacucguga      cg        -a           aauac    c   u 
Get sequence
Deep sequencing
1360 reads, 33.3 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 18516311-18516409 [-]
intergenic
KZ114877.1: 255004-255102 [-]
intergenic
KZ115174.1: 49370-49468 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-365-3
dre-mir-193a-2chr6: 18517970-18518067 [-]
dre-mir-365-3chr6: 18516311-18516409 [-]
Database links

Mature sequence dre-miR-365

Accession MIMAT0001875
Sequence

59 - 

uaaugccccuaaaaauccuuau

 - 80

Get sequence
Deep sequencing3975 reads, 8 experiments
Evidence by similarity; MI0000768
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).