Stem-loop sequence dre-mir-338-2

AccessionMI0002064 (change log)
DescriptionDanio rerio miR-338-2 stem-loop
Gene family MIPF0000097; mir-338
Literature search

4 open access papers mention dre-mir-338-2
(14 sentences)

Stem-loop
        ug - ug     cu     -  g   ag     u   -         aau    guguu 
5' gugug  u g  uguuu  ggugc cu cug  aacaa auc cugaugcug   gagu     g
   |||||  | |  |||||  ||||| || |||  ||||| ||| |||||||||   ||||      
3' uauau  g c  acggg  ucacg gg gac  uuguu uag gacuacgac   cuca     a
        gu u cu     uu     a  a   cg     u   u         ---    aagga 
Get sequence
Deep sequencing
8703 reads, 455 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr12: 17727528-17727651 [+]
sense
OTTDART00000058131 ; si:ch73-95a24.1-001; intron 1
ENSDART00000152652 ; si:ch73-95a24.1-001; intron 1
Database links

Mature sequence dre-miR-338

Accession MIMAT0001873
Sequence

71 - 

uccagcaucagugauuuuguug

 - 92

Get sequence
Deep sequencing17134 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).