Stem-loop sequence dre-mir-338-1

AccessionMI0002063 (change log)
DescriptionDanio rerio miR-338-1 stem-loop
Gene family MIPF0000097; mir-338
Literature search

4 open access papers mention dre-mir-338-1
(14 sentences)

Stem-loop
      -u     cu       uc  -         ccu     uuu 
5' ggu  ucucc  gcaacaa  uc cugaugcug   gagug   u
   |||  |||||  |||||||  || |||||||||   |||||   u
3' cca  ggagg  cguuguu  ag gacuacgac   cucac   c
      cu     -c       uu  u         ---     cuu 
Get sequence
Deep sequencing
8634 reads, 1.11e+05 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr12: 35710521-35710605 [-]
sense
OTTDART00000048001 ; aatkb-001; intron 7
ENSDART00000111560 ; aatkb-001; intron 7
KZ114929.1: 91128-91212 [-]
sense
OTTDART00000048001 ; aatkb-001; intron 7
ENSDART00000111560 ; aatkb-001; intron 7
KZ115395.1: 91834-91918 [-]
sense
OTTDART00000048001 ; aatkb-001; intron 7
ENSDART00000111560 ; aatkb-001; intron 7
Database links

Mature sequence dre-miR-338

Accession MIMAT0001873
Sequence

52 - 

uccagcaucagugauuuuguug

 - 73

Get sequence
Deep sequencing17134 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).