Stem-loop sequence dre-mir-301c

AccessionMI0002062 (change log)
DescriptionDanio rerio miR-301c stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention dre-mir-301c
(1 sentences)

Stem-loop
   u    uc  c    c       ---        a   uacca 
5'  gagg  ag ugcu ugacgau   guugcacu cug     u
    ||||  || |||| |||||||   |||||||| |||      
3'  cucc  uu acga acuguua   uaacguga gau     c
   u    ga  u    u       uga        c   cuuac 
Get sequence
Deep sequencing
7449 reads, 209 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 17454490-17454572 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-301c
dre-mir-130c-1chr10: 17453363-17453503 [+]
dre-mir-301cchr10: 17454490-17454572 [+]
Database links

Mature sequence dre-miR-301c-5p

Accession MIMAT0031991
Sequence

12 - 

gcucugacgauguugcacuac

 - 32

Get sequence
Deep sequencing365 reads, 9 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-301c-3p

Accession MIMAT0001872
Previous IDsdre-miR-301c
Sequence

50 - 

cagugcaauaguauugucauag

 - 71

Get sequence
Deep sequencing7081 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).