Stem-loop sequence dre-mir-218b

AccessionMI0002053 (change log)
DescriptionDanio rerio miR-218b stem-loop
Gene family MIPF0000026; mir-218
Literature search

6 open access papers mention dre-mir-218b
(83 sentences)

Stem-loop
       a a   uu       auc        --   uuc 
5' cagg c cca  gugcuug   uaaccaug  cag   c
   |||| | |||  |||||||   ||||||||  |||    
3' guuc g ggu  cacgaac   guugguac  guc   c
       a a   uu       cgu        cu   uuu 
Get sequence
Deep sequencing
1844 reads, 54.5 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 17695265-17695340 [+]
intergenic
Database links

Mature sequence dre-miR-218b

Accession MIMAT0001869
Sequence

11 - 

uugugcuugaucuaaccaugca

 - 32

Get sequence
Deep sequencing1844 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).