Stem-loop sequence dre-mir-218a-2

AccessionMI0002052 (change log)
DescriptionDanio rerio miR-218a-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

7 open access papers mention dre-mir-218a-2
(147 sentences)

Stem-loop
        gu     uuu         cu        ---    gca 
5' gcggg  uuucc   gugcuugau  aaccaugu   gguu   g
   |||||  |||||   |||||||||  ||||||||   ||||   a
3' cguuc  gaagg   cacgaacug  uugguaca   ucag   c
        ug     uac         uc        uaa    acu 
Get sequence
Deep sequencing
2793 reads, 63.6 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 23866878-23866965 [+]
sense
OTTDART00000041849 ; slit2-001; intron 14
ENSDART00000007531 ; slit2-001; intron 14
Database links

Mature sequence dre-miR-218a

Accession MIMAT0001868
Sequence

14 - 

uugugcuugaucuaaccaugug

 - 35

Get sequence
Deep sequencing5500 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).