Stem-loop sequence dre-mir-218a-1

AccessionMI0002051 (change log)
DescriptionDanio rerio miR-218a-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

7 open access papers mention dre-mir-218a-1
(147 sentences)

Stem-loop
       u      u         cu         cc  cgcc 
5' cagc gucucu gugcuugau  aaccaugug  gc    u
   |||| |||||| |||||||||  |||||||||  ||    a
3' gucg caggga cacgaacug  uugguacac  cg    c
       c      c         cc         uc  aaca 
Get sequence
Deep sequencing
2910 reads, 63.6 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 24562801-24562883 [-]
sense
OTTDART00000026451 ; slit3-001; intron 14
ENSDART00000146299 ; slit3-001; intron 14
KZ115446.1: 511117-511199 [-]
sense
OTTDART00000026451 ; slit3-001; intron 14
ENSDART00000146299 ; slit3-001; intron 14
Database links

Mature sequence dre-miR-218a

Accession MIMAT0001868
Sequence

11 - 

uugugcuugaucuaaccaugug

 - 32

Get sequence
Deep sequencing5500 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).