Stem-loop sequence dre-mir-206-2

AccessionMI0002046 (change log)
DescriptionDanio rerio miR-206-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

14 open access papers mention dre-mir-206-2
(190 sentences)

Stem-loop
   -ga u   c  -uug        ga g                cc     uucag 
5'    g ugg ug    cuuauuga  c acauacuuccuuauau  ccaua     a
      | ||| ||    ||||||||  | ||||||||||||||||  |||||     a
3'    c acu ac    gagugacu  g ugugugaaggaaugua  gguau     u
   cua u   -  ucua        uc g                -a     cuaau 
Get sequence
Deep sequencing
521613 reads, 3.2e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 5967238-5967346 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-206-2
dre-mir-206-2chr17: 5967238-5967346 [-]
dre-mir-133cchr17: 5962975-5963065 [-]
Database links

Mature sequence dre-miR-206-3p

Accession MIMAT0001866
Previous IDsdre-miR-206
Sequence

64 - 

uggaauguaaggaagugugugg

 - 85

Get sequence
Deep sequencing1041898 reads, 5 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).