Stem-loop sequence dre-mir-204-2

AccessionMI0002042 (change log)
DescriptionDanio rerio miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Literature search

4 open access papers mention dre-mir-204-2
(18 sentences)

Stem-loop
         -  c     ac   uuug    cuc   gg           ca     u    g  guu 
5' guguug cu uagug  cag    ugac   cug  uuucccuuugu  uccua gccu ca   c
   |||||| || |||||  |||    ||||   |||  |||||||||||  ||||| |||| ||    
3' cauaac ga aucau  guc    gcug   gac  ggagggaaacg  agggu cgga gu   c
         u  c     --   --ca    -ua   uu           ac     -    -  agu 
Get sequence
Deep sequencing
142158 reads, 8.47e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 29336996-29337119 [-]
sense
OTTDART00000037128 ; trpm1a-003; intron 5
OTTDART00000037126 ; trpm1a-001; intron 6
ENSDART00000052584 ; trpm1a-201; intron 4
ENSDART00000147919 ; trpm1a-003; intron 5
ENSDART00000140938 ; trpm1a-001; intron 6
ENSDART00000086664 ; trpm1a-202; intron 6
KZ114891.1: 43462-43585 [-]
sense
OTTDART00000037128 ; trpm1a-003; intron 5
OTTDART00000037126 ; trpm1a-001; intron 6
ENSDART00000052584 ; trpm1a-201; intron 4
ENSDART00000147919 ; trpm1a-003; intron 5
ENSDART00000140938 ; trpm1a-001; intron 6
ENSDART00000086664 ; trpm1a-202; intron 6
Database links

Mature sequence dre-miR-204-5p

Accession MIMAT0001279
Previous IDsdre-miR-204
Sequence

37 - 

uucccuuugucauccuaugccu

 - 58

Get sequence
Deep sequencing340914 reads, 11 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-204-2-3p

Accession MIMAT0031987
Sequence

74 - 

gcugggacagcaaagggaggu

 - 94

Get sequence
Deep sequencing548 reads, 9 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).