Stem-loop sequence dre-mir-203b

AccessionMI0002041 (change log)
DescriptionDanio rerio miR-203b stem-loop
Gene family MIPF0000108; mir-203
Literature search

5 open access papers mention dre-mir-203b
(9 sentences)

Stem-loop
       - -    gc           c    g    a     cuu 
5' uccu c uuug  cgagugguucu aaca uuca caguu   u
   |||| | ||||  ||||||||||| |||| |||| |||||    
3' agga g agac  guucaccagga uugu aagu guuag   u
       a c    ua           c    a    -     uag 
Get sequence
Deep sequencing
417671 reads, 2.3e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr20: 27405878-27405962 [+]
intergenic
Database links

Mature sequence dre-miR-203b-5p

Accession MIMAT0003407
Previous IDsdre-miR-203b*
Sequence

14 - 

agugguucucaacaguucaaca

 - 35

Get sequence
Deep sequencing4301 reads, 10 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-203b-3p

Accession MIMAT0001865
Previous IDsdre-miR-203b
Sequence

51 - 

gugaaauguucaggaccacuug

 - 72

Get sequence
Deep sequencing413367 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).