Stem-loop sequence dre-mir-200c

AccessionMI0002039 (change log)
DescriptionDanio rerio miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

18 open access papers mention dre-mir-200c
(202 sentences)

Stem-loop
         -  ugg  c    -    a       u     u uua 
5' uggaug cc   cu cauc uuac aggcagu uugga g   u
   |||||| ||   || |||| |||| ||||||| ||||| |    
3' aucuac gg   ga guag aaug uccguca aaucu u   a
         u  -ua  c    u    g       u     c ucu 
Get sequence
Deep sequencing
40002 reads, 3.38e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 40656204-40656288 [-]
sense
OTTDART00000055115 ; ppil1-001; intron 1
OTTDART00000055116 ; ppil1-002; intron 1
ENSDART00000154359 ; ppil1-001; intron 1
ENSDART00000153573 ; ppil1-002; intron 1
Clustered miRNAs
< 10kb from dre-mir-200c
dre-mir-200cchr6: 40656204-40656288 [-]
dre-mir-141chr6: 40656003-40656085 [-]
dre-mir-429bchr6: 40653129-40653238 [-]
Database links

Mature sequence dre-miR-200c-5p

Accession MIMAT0031986
Sequence

15 - 

caucuuacaaggcaguuuugga

 - 36

Get sequence
Deep sequencing404 reads, 10 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-200c-3p

Accession MIMAT0001863
Previous IDsdre-miR-200c
Sequence

51 - 

uaauacugccugguaaugaugc

 - 72

Get sequence
Deep sequencing39597 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).