Stem-loop sequence dre-mir-200b

AccessionMI0002038 (change log)
DescriptionDanio rerio miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

17 open access papers mention dre-mir-200b
(268 sentences)

Stem-loop
         c   uc    -    g      c      uuuca 
5' gguagu guc  cauc uuac aggcag auugga     u
   |||||| |||  |||| |||| |||||| ||||||     u
3' ccgucg uag  guag aaug uccguc uaaucu     a
         u   ua    u    g      a      uuuuc 
Get sequence
Deep sequencing
41769 reads, 1.98e+04 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24072029-24072110 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-200b
dre-mir-200bchr23: 24072029-24072110 [+]
dre-mir-200achr23: 24072160-24072245 [+]
dre-mir-429achr23: 24073815-24073896 [+]
dre-mir-7149chr23: 24074083-24074155 [+]
Database links

Mature sequence dre-miR-200b-5p

Accession MIMAT0031985
Sequence

13 - 

caucuuacgaggcagcauugga

 - 34

Get sequence
Deep sequencing403 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-200b-3p

Accession MIMAT0001862
Previous IDsdre-miR-200b
Sequence

50 - 

uaauacugccugguaaugauga

 - 71

Get sequence
Deep sequencing41365 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).