Stem-loop sequence dre-mir-200a

AccessionMI0002037 (change log)
DescriptionDanio rerio miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

19 open access papers mention dre-mir-200a
(227 sentences)

Stem-loop
     -          c    -             c    cuguau 
5' gg cacuuagcag cauc uuaccggacagug ugga      a
   || |||||||||| |||| ||||||||||||| ||||       
3' cc guggguuguu guag aauggucugucac aucu      a
     a          u    c             a    uuuguc 
Get sequence
Deep sequencing
74588 reads, 3.93e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24072160-24072245 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-200a
dre-mir-200bchr23: 24072029-24072110 [+]
dre-mir-200achr23: 24072160-24072245 [+]
dre-mir-429achr23: 24073815-24073896 [+]
dre-mir-7149chr23: 24074083-24074155 [+]
Database links

Mature sequence dre-miR-200a-5p

Accession MIMAT0031984
Sequence

14 - 

caucuuaccggacagugcugga

 - 35

Get sequence
Deep sequencing1586 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-200a-3p

Accession MIMAT0001861
Previous IDsdre-miR-200a
Sequence

52 - 

uaacacugucugguaacgaugu

 - 73

Get sequence
Deep sequencing73002 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).