Stem-loop sequence dre-mir-196b

AccessionMI0002036 (change log)
DescriptionDanio rerio miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

10 open access papers mention dre-mir-196b
(31 sentences)

Stem-loop
   gucu ug               a   g   ggc    cgu 
5'     g  auuuagguaguuuca guu uug   ugga   u
       |  ||||||||||||||| ||| |||   ||||    
3'     c  uaaguccgucaaagu caa gac   acuu   u
   accu gu               c   g   ---    uaa 
Get sequence
Deep sequencing
14453 reads, 636 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 23673377-23673455 [+]
intergenic
Database links

Mature sequence dre-miR-196b

Accession MIMAT0001860
Sequence

11 - 

uagguaguuucaaguuguuggg

 - 32

Get sequence
Deep sequencing14319 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).