Stem-loop sequence dre-mir-196a-2

AccessionMI0002035 (change log)
DescriptionDanio rerio miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Literature search

9 open access papers mention dre-mir-196a-2
(92 sentences)

Stem-loop
   ucga ug   u  gu             u   a  ac 
5'     g  guu ag  aguuucauguugu ggg uu  a
       |  ||| ||  ||||||||||||| ||| ||   
3'     c  uaa uc  ucaaagugcaacg cuc aa  u
   accc gu   u  ug             u   a  cu 
Get sequence
Deep sequencing
18299 reads, 691 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 19747619-19747694 [+]
sense
OTTDART00000018144 ; hoxa9a-002; intron 1
ENSDART00000147736 ; hoxa9a-002; intron 1
antisense
OTTDART00000059902 ; si:dkey-25e11.13-003; intron 1
OTTDART00000018121 ; evx1-001; intron 2
OTTDART00000043481 ; si:dkey-25e11.13-001; intron 2
ENSDART00000157108 ; si:dkey-25e11.13-003; intron 1
ENSDART00000147608 ; evx1-001; intron 2
ENSDART00000132654 ; si:dkey-25e11.13-001; intron 2
Database links

Mature sequence dre-miR-196a-5p

Accession MIMAT0001276
Previous IDsdre-miR-196a
Sequence

11 - 

uagguaguuucauguuguuggg

 - 32

Get sequence
Deep sequencing35528 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-196a-3p

Accession MIMAT0031983
Sequence

47 - 

cugcaacgugaaacugucuuaa

 - 68

Get sequence
Deep sequencing537 reads, 10 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).