Stem-loop sequence dre-mir-194b

AccessionMI0002034 (change log)
DescriptionDanio rerio miR-194b stem-loop
Gene family MIPF0000055; mir-194
Literature search

7 open access papers mention dre-mir-194b
(24 sentences)

Stem-loop
       g   g u        cgc      u  aaa  gca 
5' gcuc cug g guaacagc   uccaug gg   au   u
   |||| ||| | ||||||||   |||||| ||   ||    
3' ugag gac u cauugucg   aggugc cc   ug   u
       a   g c        aau      -  --g  aac 
Get sequence
Deep sequencing
214 reads, 10 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 45468955-45469031 [-]
intergenic
Database links

Mature sequence dre-miR-194b

Accession MIMAT0001859
Sequence

11 - 

uguaacagccgcuccaugugga

 - 32

Get sequence
Deep sequencing207 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).