Stem-loop sequence dre-mir-194a

AccessionMI0002033 (change log)
DescriptionDanio rerio miR-194a stem-loop
Gene family MIPF0000055; mir-194
Literature search

7 open access papers mention dre-mir-194a
(24 sentences)

Stem-loop
   u    -   a    u          a      g       uu 
5'  ggug cug cugc uguaacagca cuccau uggaagg  u
    |||| ||| |||| |||||||||| |||||| |||||||   
3'  ccac gau gacg gcguugucgu gaggug accuucu  g
   a    u   a    u          c      -       gu 
Get sequence
Deep sequencing
3322 reads, 136 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 27063174-27063257 [+]
intergenic
KZ114914.1: 88587-88670 [+]
intergenic
KZ115324.1: 286303-286386 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-194a
dre-mir-194achr10: 27063174-27063257 [+]
dre-mir-192chr10: 27063354-27063438 [+]
Database links

Mature sequence dre-miR-194a

Accession MIMAT0001858
Sequence

15 - 

uguaacagcaacuccaugugg

 - 35

Get sequence
Deep sequencing3297 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).