Stem-loop sequence dre-mir-181c

AccessionMI0002024 (change log)
Previous IDsdre-mir-181c-1
DescriptionDanio rerio miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

9 open access papers mention dre-mir-181c
(31 sentences)

Stem-loop
        c  a   a         cug          uuau 
5' ggguc ug uuc cauucauug   ucgguggguu    c
   ||||| || ||| |||||||||   ||||||||||     
3' cucgg au aag guaaguaac   ggccgcucag    u
        c  c   a         --a          cuuc 
Get sequence
Deep sequencing
88674 reads, 5.26e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 34197694-34197771 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181c
dre-mir-181a-3chr3: 34197447-34197530 [+]
dre-mir-181cchr3: 34197694-34197771 [+]
Database links

Mature sequence dre-miR-181c-5p

Accession MIMAT0001852
Previous IDsdre-miR-181c
Sequence

12 - 

cacauucauugcugucgguggg

 - 33

Get sequence
Deep sequencing88450 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-181c-3p

Accession MIMAT0031980
Sequence

48 - 

cucgccggacaaugaaugagaa

 - 69

Get sequence
Deep sequencing224 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).