Stem-loop sequence dre-mir-155

AccessionMI0002023 (change log)
DescriptionDanio rerio miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

9 open access papers mention dre-mir-155
(47 sentences)

Stem-loop
            u           c  g     g     gu 
5' uggugcagg uuaaugcuaau gu auagg guuua  g
   ||||||||| ||||||||||| || ||||| |||||  c
3' aucgcguuc aauuacgauug cg uaucc caagu  u
            u           u  -     a     ag 
Get sequence
Deep sequencing
1961 reads, 36.4 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 576444-576521 [+]
sense
OTTDART00000040955 ; mrpl39-002; intron 10
ENSDART00000060944 ; mrpl39-002; intron 10
Database links

Mature sequence dre-miR-155

Accession MIMAT0001851
Sequence

11 - 

uuaaugcuaaucgugauagggg

 - 32

Get sequence
Deep sequencing1958 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).