Stem-loop sequence dre-mir-146b

AccessionMI0002013 (change log)
Previous IDsdre-mir-146b-1
DescriptionDanio rerio miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

5 open access papers mention dre-mir-146b
(126 sentences)

Stem-loop
     -   ug    u              aa    gucugcu 
5' gc ucu  gcuu gagaacugaauucc  gggu       u
   || |||  |||| ||||||||||||||  ||||        
3' cg agg  ugaa uucuugacuugagg  cccg       u
     u   uu    -              ca    acuuaua 
Get sequence
Deep sequencing
26165 reads, 1.36e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 41639979-41640058 [+]
intergenic
Database links

Mature sequence dre-miR-146b

Accession MIMAT0001844
Sequence

12 - 

ugagaacugaauuccaagggug

 - 33

Get sequence
Deep sequencing25998 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).