Stem-loop sequence dre-mir-145

AccessionMI0002010 (change log)
Previous IDsdre-mir-145-1
DescriptionDanio rerio miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

10 open access papers mention dre-mir-145
(186 sentences)

Stem-loop
        cu  aucauuu     u        uc    u  c             ggg a 
5' ucagu  uc       ccuca ccccgggg  cagu uu ccaggaaucccuu   c a
   |||||  ||       ||||| ||||||||  |||| || |||||||||||||   |  
3' aguca  ag       ggggu gggguucu  guca aa gguccuuaggggg   g u
        uc  ----guc     u        -u    u  a             aaa c 
Get sequence
Deep sequencing
4280 reads, 464 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 38743941-38744053 [+]
intergenic
KZ115462.1: 19335-19447 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-145
dre-mir-143chr14: 38742313-38742411 [+]
dre-mir-145chr14: 38743941-38744053 [+]
Database links

Mature sequence dre-miR-145-5p

Accession MIMAT0001842
Previous IDsdre-miR-145
Sequence

30 - 

guccaguuuucccaggaauccc

 - 51

Get sequence
Deep sequencing2870 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-145-3p

Accession MIMAT0031976
Sequence

69 - 

ggauuccuggaaauacuguucu

 - 90

Get sequence
Deep sequencing1394 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).