Stem-loop sequence dre-mir-144

AccessionMI0002009 (change log)
DescriptionDanio rerio miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

5 open access papers mention dre-mir-144
(17 sentences)

Stem-loop
   --------       a  c  g        g         --ag    u 
5'         gcucucu ga ag auaucauc uauacugua    uuca u
           ||||||| || || |||||||| |||||||||    ||||  
3'         uggggga cu uc uguaguag auaugacau    gagu a
   cgagcaac       c  a  a        -         caca    u 
Get sequence
Deep sequencing
1913 reads, 55.6 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 42272074-42272162 [-]
sense
OTTDART00000022480 ; si:ch211-207c6.2-001; exon 2
ENSDART00000137692 ; si:ch211-207c6.2-001; exon 2
Clustered miRNAs
< 10kb from dre-mir-144
dre-mir-144chr5: 42272074-42272162 [-]
dre-mir-451chr5: 42271971-42272030 [-]
Database links

Mature sequence dre-miR-144-5p

Accession MIMAT0031975
Sequence

13 - 

ggauaucaucguauacuguaagu

 - 35

Get sequence
Deep sequencing1849 reads, 9 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-144-3p

Accession MIMAT0001841
Previous IDsdre-miR-144
Sequence

51 - 

uacaguauagaugauguacu

 - 70

Get sequence
Deep sequencing64 reads, 7 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).