Stem-loop sequence dre-mir-143

Accession

MI0002007 (change log)

Description

Danio rerio miR-143 stem-loop

Gene family

MIPF0000094; mir-143

Literature search

7 open access papers mention dre-mir-143
(17 sentences)

Stem-loop

     u  -     --c    gg    c g         g      u  -  aa 
5' ga cu acagu   gucu  cccg g ugcagugcu caucuc gg uc  c
   || || |||||   ||||  |||| | ||||||||| |||||| || ||   
3' cu ga uguca   cagg  gggc c augucacga guagag cu ag  u
     c  c     caa    -a    u g         a      u  g  gg 

Deep sequencing

73386 reads, 4.38e+03 reads per million, 11 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The cloned mature miR-143 sequence always appears to be 22nt in length, modified by the addition of a 3' U residue not found in the genomic sequence [1].

Genome context

Coordinates (GRCz11; GCA_000002035.4)	Overlapping transcripts
chr14: 38742313-38742411 [+]	intergenic
KZ115462.1: 17707-17805 [+]	intergenic

Clustered miRNAs

< 10kb from dre-mir-143

• dre-mir-143: chr14: 38742313-38742411 [+]
• dre-mir-145: chr14: 38743941-38744053 [+]

Database links

• EntrezGene:mir143-1
• EntrezGene:mir143-1
• miRBase Tracker:MI0002007

Mature sequence dre-miR-143

• Accession: MIMAT0001840
• Sequence: 57 - ugagaugaagcacuguagcuc - 77
• Deep sequencing: 73255 reads, 11 experiments
• Evidence: experimental; cloned [1]
• Predicted targets:
  • TargetScanFish:dre-miR-143

References

1. PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).