Stem-loop sequence dre-mir-141

AccessionMI0002004 (change log)
DescriptionDanio rerio miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

6 open access papers mention dre-mir-141
(65 sentences)

Stem-loop
      u       a    -     u       c    cugu    
5' guc cuagggu cauc uuacc gacagug uugg    uca 
   ||| ||||||| |||| ||||| ||||||| ||||    || c
3' cag ggucuca guag aaugg cugucac aauc    agu 
      u       c    c     u       -    uugu    
Get sequence
Deep sequencing
71648 reads, 3.81e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 40656003-40656085 [-]
sense
OTTDART00000055115 ; ppil1-001; intron 1
OTTDART00000055116 ; ppil1-002; intron 1
ENSDART00000154359 ; ppil1-001; intron 1
ENSDART00000153573 ; ppil1-002; intron 1
Clustered miRNAs
< 10kb from dre-mir-141
dre-mir-200cchr6: 40656204-40656288 [-]
dre-mir-141chr6: 40656003-40656085 [-]
dre-mir-429bchr6: 40653129-40653238 [-]
Database links

Mature sequence dre-miR-141-5p

Accession MIMAT0031974
Sequence

13 - 

caucuuaccugacagugcuugg

 - 34

Get sequence
Deep sequencing291 reads, 10 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-141-3p

Accession MIMAT0001837
Previous IDsdre-miR-141
Sequence

51 - 

uaacacugucugguaacgaugc

 - 72

Get sequence
Deep sequencing71356 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).