Stem-loop sequence dre-mir-133a-2

AccessionMI0001992 (change log)
DescriptionDanio rerio miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

28 open access papers mention dre-mir-133a-2
(121 sentences)

Stem-loop
        uuu    a       aa  u  a        aacug 
5' aaugc   gcua agcuggu  aa gg accaaauc     u
   |||||   |||| |||||||  || || ||||||||      
3' uuacg   cgau ucgacca  uu cc ugguuuag     u
        ugu    g       ac  c  c        guauu 
Get sequence
Deep sequencing
21380 reads, 500 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 7172120-7172203 [-]
sense
OTTDART00000059680 ; si:dkey-53i3.1-001; exon 3
ENSDART00000156369 ; si:dkey-53i3.1-001; exon 3
Database links

Mature sequence dre-miR-133a-2-5p

Accession MIMAT0031970
Sequence

14 - 

agcugguaaaauggaaccaaa

 - 34

Get sequence
Deep sequencing7166 reads, 5 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-133a-3p

Accession MIMAT0001830
Previous IDsdre-miR-133a
Sequence

51 - 

uuugguccccuucaaccagcug

 - 72

Get sequence
Deep sequencing28428 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).