Stem-loop sequence dre-mir-132-2

AccessionMI0001991 (change log)
Previous IDsdre-mir-132-3
DescriptionDanio rerio miR-132-2 stem-loop
Gene family MIPF0000065; mir-132
Literature search

9 open access papers mention dre-mir-132-2
(144 sentences)

Stem-loop
       uuccuc      --------    a  c           u            gua    u 
5' uccc      ugcugu        cucc ug ugaccguggcu uagauuguuacu   gcgu g
   ||||      ||||||        |||| || ||||||||||| ||||||||||||   ||||  
3' aggg      gcgaca        gggg ac gcugguaccga aucugacaaugg   ugca g
       ucauca      uuguggac    a  c           c            ---    c 
Get sequence
Deep sequencing
729 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 35645017-35645135 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-132-2
dre-mir-212-2chr10: 35644706-35644798 [+]
dre-mir-132-2chr10: 35645017-35645135 [+]
dre-mir-2184chr10: 35654245-35654354 [-]
Database links

Mature sequence dre-miR-132-3p

Accession MIMAT0001829
Previous IDsdre-miR-132
Sequence

66 - 

uaacagucuacagccauggucg

 - 87

Get sequence
Deep sequencing381 reads, 9 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).