Stem-loop sequence dre-mir-132-1

AccessionMI0001989 (change log)
DescriptionDanio rerio miR-132-1 stem-loop
Gene family MIPF0000065; mir-132
Literature search

9 open access papers mention dre-mir-132-1
(144 sentences)

Stem-loop
   -   uc a             au             u    ac 
5'  guc  c uggcgaccguggc  uagauuguuacug agga  a
    |||  | |||||||||||||  ||||||||||||| ||||   
3'  cgg  g aucgcugguaccg  aucugacaauggu uuuu  g
   a   gu -             ac             -    aa 
Get sequence
Deep sequencing
660 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 25897715-25897799 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-132-1
dre-mir-212chr15: 25897446-25897539 [+]
dre-mir-132-1chr15: 25897715-25897799 [+]
Database links

Mature sequence dre-miR-132-5p

Accession MIMAT0003403
Previous IDsdre-miR-132*
Sequence

13 - 

accguggcauuagauuguuacu

 - 34

Get sequence
Deep sequencing468 reads, 9 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-132-3p

Accession MIMAT0001829
Previous IDsdre-miR-132
Sequence

54 - 

uaacagucuacagccauggucg

 - 75

Get sequence
Deep sequencing381 reads, 9 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).