Stem-loop sequence dre-mir-130c-1

AccessionMI0001987 (change log)
DescriptionDanio rerio miR-130c-1 stem-loop
Gene family MIPF0000034; mir-130
Literature search

5 open access papers mention dre-mir-130c-1
(12 sentences)

Stem-loop
           uc  uac     uauu   ca        ---   u         uc         a  ggcca 
5' gggagagg  ug   gguga    gac  uguuuugu   cca ugcccuuuu  uguuguacu cu     a
   ||||||||  ||   |||||    |||  ||||||||   ||| |||||||||  ||||||||| ||     u
3' uccucucc  ac   ccacu    cug  acaagaua   ggu acgggaaaa  auaacguga ga     c
           -c  ucu     --uc   ag        guc   u         uu         c  gaaga 
Get sequence
Deep sequencing
40600 reads, 1.33e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 17453363-17453503 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-130c-1
dre-mir-130c-1chr10: 17453363-17453503 [+]
dre-mir-301cchr10: 17454490-17454572 [+]
Database links

Mature sequence dre-miR-130c-5p

Accession MIMAT0031969
Sequence

43 - 

gcccuuuuucuguuguacuacu

 - 64

Get sequence
Deep sequencing573 reads, 9 experiments
Evidence not experimental

Mature sequence dre-miR-130c-3p

Accession MIMAT0001828
Previous IDsdre-miR-130c
Sequence

80 - 

cagugcaauauuaaaagggcau

 - 101

Get sequence
Deep sequencing80600 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).