Stem-loop sequence dre-mir-130b

AccessionMI0001986 (change log)
DescriptionDanio rerio miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

6 open access papers mention dre-mir-130b
(9 sentences)

Stem-loop
   cu  u c    ca       cc         -----a   ug   
5'   gu g cuga  cucuuuc  uguugcacu      cug  gg 
     || | ||||  |||||||  |||||||||      |||  | a
3'   ca c gacu  gggaaag  auaacguga      gac  cg 
   gu  c u    ac       ua         cgaaac   gu   
Get sequence
Deep sequencing
30566 reads, 945 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 13299331-13299414 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-130b
dre-mir-301bchr5: 13289353-13289433 [+]
dre-mir-454bchr5: 13296307-13296422 [+]
dre-mir-130bchr5: 13299331-13299414 [+]
Database links

Mature sequence dre-miR-130b

Accession MIMAT0001827
Sequence

53 - 

cagugcaauaaugaaagggcau

 - 74

Get sequence
Deep sequencing28302 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).