Stem-loop sequence dre-mir-130a

AccessionMI0001984 (change log)
Previous IDsdre-mir-130a-1
DescriptionDanio rerio miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

6 open access papers mention dre-mir-130a
(135 sentences)

Stem-loop
   ug    u         c   u          a  --        
5'   ucug ccagugccc uuu auauuguacu cu  gauaacc 
     |||| ||||||||| ||| |||||||||| ||  |||||| c
3'   ggac gguuacggg aaa uguaacguga ga  uuauuga 
   ag    c         a   u          c  aa        
Get sequence
Deep sequencing
38302 reads, 1.31e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 33377130-33377214 [-]
sense
ENSDART00000023509 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-130a
dre-mir-130achr10: 33377130-33377214 [-]
dre-mir-301achr10: 33377001-33377086 [-]
dre-mir-454achr10: 33376818-33376941 [-]
Database links

Mature sequence dre-miR-130a

Accession MIMAT0001826
Sequence

54 - 

cagugcaauguuaaaagggcau

 - 75

Get sequence
Deep sequencing38272 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).