Stem-loop sequence dre-mir-129-2

Accession MI0001982
Description Danio rerio miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       a     -       c   cu      g     cuca 
gucuuuc cgaau cuuuuug ggu  gggcuu cuguu    a
||||||| ||||| ||||||| |||  |||||| |||||     
cgggagg guuua gaaaaac cca  cccgaa gguaa    c
       c     c       c   uu      g     cuau 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
7: 51744921-51745007 [-]
intergenic
Database links

Mature sequence dre-miR-129-5p

Accession MIMAT0001825
Previous IDs dre-miR-129
Sequence

14 - 

cuuuuugcggucugggcuugcu

 - 35

Get sequence
Evidence experimental; cloned [1]

Mature sequence dre-miR-129-3p

Accession MIMAT0003158
Previous IDs dre-miR-129*
Sequence

55 - 

aagcccuuaccccaaaaagcau

 - 76

Get sequence
Evidence experimental; array [2]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).