Stem-loop sequence dre-mir-124-3

AccessionMI0001968 (change log)
DescriptionDanio rerio miR-124-3 stem-loop
Gene family MIPF0000021; mir-124
Literature search

23 open access papers mention dre-mir-124-3
(78 sentences)

Stem-loop
      u    gg   ---uuc  a     g    cc        a   ga        -   u 
5' ggc cugu  gau      ag cucug cuuu  guguucac gcg  ccuugauu uaa g
   ||| ||||  |||      || ||||| ||||  |||||||| |||  |||||||| |||  
3' ccg gacg  cua      uc gaggc gaga  cguaagug cgc  ggaauuaa auu u
      -    -a   caauuu  c     -    ac        g   ac        c   c 
Get sequence
Deep sequencing
8542 reads, 275 reads per million, 8 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 24455632-24455748 [+]
antisense
OTTDART00000059869 ; si:ch211-277b21.2-001; intron 1
ENSDART00000156423 ; si:ch211-277b21.2-001; intron 1
Database links

Mature sequence dre-miR-124-5p

Accession MIMAT0031960
Sequence

31 - 

cguguucacagcggaccuugau

 - 52

Get sequence
Deep sequencing10884 reads, 5 experiments
Evidence not experimental

Mature sequence dre-miR-124-3p

Accession MIMAT0001819
Previous IDsdre-miR-124
Sequence

68 - 

uaaggcacgcggugaaugccaa

 - 89

Get sequence
Deep sequencing29486 reads, 8 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).