Stem-loop sequence dre-mir-103

Accession MI0001962
Description Danio rerio miR-103 stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uu    u     g   --   u  u           c   uggaa 
  gccc ggucu uca  gcc cu uacggugcugc uug     u
  |||| ||||| |||  ||| || ||||||||||| |||      
  cggg ccaga agu  cgg ga auguuacgacg aac     c
cc    c     g   au   -  c           -   uaggu 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
13: 15177271-15177358 [+]
sense
OTTDART00000037613 ; zgc:158667-001; intron 5
OTTDART00000037613 ; zgc:158667-001; intron 5
OTTDART00000037613 ; zgc:158667-001; intron 5
ENSDART00000133041 ; zgc:158667-001; intron 5
ENSDART00000079211 ; zgc:158667-201; intron 5
ENSDART00000133041 ; zgc:158667-001; intron 5
ENSDART00000079211 ; zgc:158667-201; intron 5
ENSDART00000133041 ; zgc:158667-001; intron 5
ENSDART00000079211 ; zgc:158667-201; intron 5
Database links

Mature sequence dre-miR-103

Accession MIMAT0001816
Sequence

53 - 

agcagcauuguacagggcuauga

 - 75

Get sequence
Evidence by similarity; MI0000108

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).