Stem-loop sequence dre-mir-101b

AccessionMI0001961 (change log)
DescriptionDanio rerio miR-101b stem-loop
Gene family MIPF0000046; mir-101
Literature search

4 open access papers mention dre-mir-101b
(6 sentences)

Stem-loop
        u c --uca  -a      c                    cg     g  ug 
5' gcucc c g     ug  auuguc auuuucaguuaucaugguac  gugcu ug  c
   ||||| | |     ||  |||||| ||||||||||||||||||||  ||||| ||  c
3' ugagg g c     ac  uggcag uagaagucaauaguaucaug  cauga ac  u
        u a uacaa  cg      u                    -a     -  ug 
Get sequence
Deep sequencing
12743 reads, 727 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 1837149-1837260 [-]
sense
ENSDART00000055878 ; rcl1-201; intron 8
Database links

Mature sequence dre-miR-101b

Accession MIMAT0001815
Sequence

64 - 

uacaguacuaugauaacugaag

 - 85

Get sequence
Deep sequencing12573 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).