Stem-loop sequence dre-mir-101a

Accession MI0001960
Description Danio rerio miR-101a stem-loop
Gene family MIPF0000046; mir-101
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u   c gg                   a    gucca 
ggc gcc u  uucaguuaucacagugcug ugcu     u
||| ||| |  ||||||||||||||||||| ||||      
ccg cgg a  aagucaauagugucaugac augg     c
   u   u gg                   -    aaauu 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
6: 31057616-31057696 [+]
intergenic
Database links

Mature sequence dre-miR-101a

Accession MIMAT0001814
Sequence

50 - 

uacaguacugugauaacugaag

 - 71

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).