Stem-loop sequence dre-mir-101a

AccessionMI0001960 (change log)
DescriptionDanio rerio miR-101a stem-loop
Gene family MIPF0000046; mir-101
Literature search

7 open access papers mention dre-mir-101a
(10 sentences)

Stem-loop
      u   c gg                   a    gucca 
5' ggc gcc u  uucaguuaucacagugcug ugcu     u
   ||| ||| |  ||||||||||||||||||| ||||      
3' ccg cgg a  aagucaauagugucaugac augg     c
      u   u gg                   -    aaauu 
Get sequence
Deep sequencing
20279 reads, 1.09e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 31365446-31365526 [+]
intergenic
Database links

Mature sequence dre-miR-101a

Accession MIMAT0001814
Sequence

50 - 

uacaguacugugauaacugaag

 - 71

Get sequence
Deep sequencing20182 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).