Stem-loop sequence dre-mir-96

AccessionMI0001955 (change log)
DescriptionDanio rerio miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

7 open access papers mention dre-mir-96
(73 sentences)

Stem-loop
       ---------------    -c   -    ug     u         g     uu      uuuuau 
5' gcug               ggcg  ucu ucuu  ccugu uuggcacua cacau  uugcuu      a
   ||||               ||||  ||| ||||  ||||| ||||||||| |||||  ||||||      u
3' cgac               ucgu  aga agaa  gggua aaccgugau gugua  aacgag      a
       uaaaaaaaaaauuca    ac   c    ca     u         -     uu      uuccau 
Get sequence
Deep sequencing
957 reads, 7.38e+04 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 15074715-15074839 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-96
dre-mir-183chr4: 15074566-15074663 [+]
dre-mir-96chr4: 15074715-15074839 [+]
dre-mir-182chr4: 15075665-15075732 [+]
Database links

Mature sequence dre-miR-96-5p

Accession MIMAT0001811
Previous IDsdre-miR-96
Sequence

24 - 

uuuggcacuagcacauuuuugcu

 - 46

Get sequence
Deep sequencing901 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-96-3p

Accession MIMAT0031956
Sequence

66 - 

caauuauguguagugccaauau

 - 87

Get sequence
Deep sequencing50 reads, 7 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).