Stem-loop sequence dre-mir-92b

AccessionMI0001953 (change log)
DescriptionDanio rerio miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

8 open access papers mention dre-mir-92b
(29 sentences)

Stem-loop
   uccuacggg         g       uu           uucaa 
5'          cagggaggu ugggaug  gugcaguguug     u
            ||||||||| |||||||  |||||||||||     c
3'          gucccuccg gcccugc  cacguuauaac     u
   -------ca         -       -u           cgccc 
Get sequence
Deep sequencing
9801 reads, 418 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 42898429-42898510 [+]
sense
OTTDART00000059956 ; si:dkey-181d19.6-001; intron 1
OTTDART00000059957 ; si:dkey-181d19.6-002; exon 1
ENSDART00000156767 ; si:dkey-181d19.6-001; intron 1
ENSDART00000153501 ; si:dkey-181d19.6-002; exon 1
Database links

Mature sequence dre-miR-92b-5p

Accession MIMAT0031955
Sequence

15 - 

aggugugggauguugugcaguguu

 - 38

Get sequence
Deep sequencing639 reads, 4 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-92b-3p

Accession MIMAT0001809
Previous IDsdre-miR-92b
Sequence

56 - 

uauugcacucgucccggccucc

 - 77

Get sequence
Deep sequencing9160 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).