Stem-loop sequence dre-mir-30a

AccessionMI0001940 (change log)
DescriptionDanio rerio miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

10 open access papers mention dre-mir-30a
(152 sentences)

Stem-loop
      uc  u c   u         ccc            ua  gc 
5' ggc  cu g agu guaaacauu   gacuggaaguug  au  a
   |||  || | ||| |||||||||   ||||||||||||  ||  g
3' ccg  gg c ucg cguuuguag   cugacuuucgac  ua  a
      gu  u a   u         --u            uc  aa 
Get sequence
Deep sequencing
65346 reads, 3.4e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 4737576-4737664 [+]
intergenic
Database links

Mature sequence dre-miR-30a-5p

Accession MIMAT0001803
Previous IDsdre-miR-30a
Sequence

14 - 

uguaaacauucccgacuggaag

 - 35

Get sequence
Deep sequencing60552 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-30a-3p

Accession MIMAT0031951
Sequence

57 - 

cuuucagucugauguuugcugc

 - 78

Get sequence
Deep sequencing4767 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).