Stem-loop sequence dre-mir-29a

AccessionMI0001938 (change log)
Previous IDsdre-mir-29a-1
DescriptionDanio rerio miR-29a stem-loop
Gene family MIPF0000009; mir-29
Literature search

16 open access papers mention dre-mir-29a
(108 sentences)

Stem-loop
   u     cccucaucucucucucucuc      ccaaacg            cuu       u   - u cc 
5'  gaaga                    ucccca       augacugauuuc   uggugcu aga g c  a
    |||||                    ||||||       ||||||||||||   ||||||| ||| | |   
3'  cuucu                    aggggu       uauuggcuaaag   accacga ucu c g  u
   a     ---------------uaacu      -caguaa            uuu       -   a u uc 
Get sequence
Deep sequencing
2334 reads, 1.77e+05 reads per million, 18 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 11606758-11606883 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-29a
dre-mir-29b-2chr4: 11608196-11608283 [-]
dre-mir-29achr4: 11606758-11606883 [-]
Database links

Mature sequence dre-miR-29a

Accession MIMAT0001802
Sequence

81 - 

uagcaccauuugaaaucgguua

 - 102

Get sequence
Deep sequencing2085 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).