Stem-loop sequence dre-mir-29b-2

AccessionMI0001934 (change log)
DescriptionDanio rerio miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

13 open access papers mention dre-mir-29b-2
(146 sentences)

Stem-loop
   u       c   -           c      gu      -g  uu 
5'  cuuccuc aga ugcugguuuca auggug  uuagau  ug  c
    ||||||| ||| ||||||||||| ||||||  ||||||  ||   
3'  ggagggg ucu gugacuaaagu uaccac  gaucug  ac  u
   g       u   u           u      --      aa  ca 
Get sequence
Deep sequencing
1130 reads, 63.6 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 11608196-11608283 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-29b-2
dre-mir-29b-2chr4: 11608196-11608283 [-]
dre-mir-29achr4: 11606758-11606883 [-]
Database links

Mature sequence dre-miR-29b

Accession MIMAT0001801
Sequence

55 - 

uagcaccauuugaaaucagugu

 - 76

Get sequence
Deep sequencing2126 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).