Stem-loop sequence dre-mir-29b-1

AccessionMI0001933 (change log)
DescriptionDanio rerio miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

14 open access papers mention dre-mir-29b-1
(148 sentences)

Stem-loop
   cu  u  u    -     a            ca    -  auu 
5'   gc cc ggaa gcuga uucagauggugc  uaga gu   u
     || || |||| ||||| ||||||||||||  |||| ||    
3'   cg gg ccuu ugacu aaguuuaccacg  aucu cg   u
   gc  -  u    g     a            --    a  gua 
Get sequence
Deep sequencing
1093 reads, 63.6 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 47467910-47467992 [+]
intergenic
Database links

Mature sequence dre-miR-29b

Accession MIMAT0001801
Sequence

52 - 

uagcaccauuugaaaucagugu

 - 73

Get sequence
Deep sequencing2126 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).