Stem-loop sequence dre-mir-27e

AccessionMI0001932 (change log)
DescriptionDanio rerio miR-27e stem-loop
Gene family MIPF0000036; mir-27
Literature search

6 open access papers mention dre-mir-27e
(18 sentences)

Stem-loop
         --ac      ac     a           aucg       u ga  cc 
5' gucauc    ucgcuc  ggcgc gagcuuagcua    gugagca u  uc  u
   ||||||    ||||||  ||||| |||||||||||    ||||||| |  ||   
3' caguag    agugag  cugug cuugaaucggu    cacuugu a  ag  u
         ggca      gu     a           --ga       c aa  aa 
Get sequence
Deep sequencing
134193 reads, 8.25e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 5299951-5300056 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27e
dre-mir-23a-1chr22: 5293213-5293301 [+]
dre-mir-27echr22: 5299951-5300056 [+]
dre-mir-24-4chr22: 5307485-5307574 [+]
Database links

Mature sequence dre-miR-27e

Accession MIMAT0001800
Sequence

65 - 

uucacaguggcuaaguucagug

 - 86

Get sequence
Deep sequencing134096 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).