Stem-loop sequence dre-mir-27d

AccessionMI0001931 (change log)
DescriptionDanio rerio miR-27d stem-loop
Gene family MIPF0000036; mir-27
Literature search

7 open access papers mention dre-mir-27d
(20 sentences)

Stem-loop
   u   gag      c            auug       --u    g 
5'  ucu   cgggug agagcuuggcug    gugaacg   gcau g
    |||   |||||| ||||||||||||    |||||||   |||| c
3'  aga   gcccac ucuugaaucggu    cacuugu   ugug u
   a   aaa      u            --ga       uuu    u 
Get sequence
Deep sequencing
177854 reads, 1.09e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 15954727-15954815 [+]
antisense
OTTDART00000043259 ; si:dkey-3h23.2-002; intron 2
OTTDART00000043258 ; si:dkey-3h23.2-001; intron 3
ENSDART00000142357 ; si:dkey-3h23.2-002; intron 2
ENSDART00000144692 ; si:dkey-3h23.2-001; intron 3
Clustered miRNAs
< 10kb from dre-mir-27d
dre-mir-23bchr10: 15954579-15954659 [+]
dre-mir-27dchr10: 15954727-15954815 [+]
dre-mir-24-1chr10: 15960835-15960914 [+]
Database links

Mature sequence dre-miR-27d

Accession MIMAT0001799
Sequence

57 - 

uucacaguggcuaaguucuuca

 - 78

Get sequence
Deep sequencing174845 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).