Stem-loop sequence dre-mir-27b

AccessionMI0001929 (change log)
DescriptionDanio rerio miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

9 open access papers mention dre-mir-27b
(112 sentences)

Stem-loop
           ag                   auug        u  uu 
5' ucuuuucu  caggugcagagcuuagcug    gugaacag ga  g
   ||||||||  |||||||||||||||||||    |||||||| ||   
3' aggagagg  gucuacgucuugaaucggu    cacuuguu cu  a
           -a                   --ga        u  ca 
Get sequence
Deep sequencing
208758 reads, 1.27e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 30167435-30167525 [-]
sense
OTTDART00000035785 ; zgc:162939-004; intron 5
OTTDART00000035782 ; zgc:162939-002; intron 6
OTTDART00000035783 ; zgc:162939-001; intron 15
ENSDART00000139864 ; C8H9orf3-004; intron 5
ENSDART00000143809 ; C8H9orf3-001; intron 6
ENSDART00000111358 ; C8H9orf3-002; intron 15
KZ115267.1: 352345-352435 [-]
sense
OTTDART00000035785 ; zgc:162939-004; intron 5
OTTDART00000035782 ; zgc:162939-002; intron 6
OTTDART00000035783 ; zgc:162939-001; intron 15
ENSDART00000139864 ; C8H9orf3-004; intron 5
ENSDART00000143809 ; C8H9orf3-001; intron 6
ENSDART00000111358 ; C8H9orf3-002; intron 15
Clustered miRNAs
< 10kb from dre-mir-27b
dre-mir-23b-2chr8: 30167625-30167708 [-]
dre-mir-27bchr8: 30167435-30167525 [-]
dre-mir-24-3chr8: 30162492-30162633 [-]
Database links

Mature sequence dre-miR-27b-5p

Accession MIMAT0031950
Sequence

18 - 

agagcuuagcugauuggugaaca

 - 40

Get sequence
Deep sequencing3416 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-27b-3p

Accession MIMAT0001797
Previous IDsdre-miR-27b
Sequence

57 - 

uucacaguggcuaaguucugca

 - 78

Get sequence
Deep sequencing205340 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).