Stem-loop sequence dre-mir-27a

AccessionMI0001928 (change log)
DescriptionDanio rerio miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

10 open access papers mention dre-mir-27a
(104 sentences)

Stem-loop
   u    aua    g  ugc  -aa      u    u  a          cacu         gaucuc  a 
5'  cugg   ugau uc   ug   guuucg gagg gc ggacuuagcu    cugugaaca      gg u
    ||||   |||| ||   ||   |||||| |||| || ||||||||||    |||||||||      ||  
3'  gacc   acua ag   ac   cggagu cucc cg cuugaaucgg    gacacuugu      cc a
   g    --g    a  cuc  acc      -    u  c          ---u         ----au  u 
Get sequence
Deep sequencing
199033 reads, 1.22e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 33902325-33902455 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27a
dre-mir-23a-3chr2: 33900435-33900512 [+]
dre-mir-27achr2: 33902325-33902455 [+]
dre-mir-24bchr2: 33905762-33905845 [+]
Database links

Mature sequence dre-miR-27a-5p

Accession MIMAT0031949
Sequence

37 - 

aggacuuagcucacucugugaaca

 - 60

Get sequence
Deep sequencing15878 reads, 9 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-27a-3p

Accession MIMAT0001796
Previous IDsdre-miR-27a
Sequence

79 - 

uucacaguggcuaaguuccgcu

 - 100

Get sequence
Deep sequencing183138 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).