Stem-loop sequence dre-mir-26b

AccessionMI0001927 (change log)
DescriptionDanio rerio miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

6 open access papers mention dre-mir-26b
(11 sentences)

Stem-loop
     auu       ug     uu         c         -----    u 
5' gc   uggccuu  ccugg  caaguaauc aggauaggu     uagu c
   ||   |||||||  |||||  ||||||||| |||||||||     ||||  
3' cg   aucggag  ggacu  guucauugg ucuuauccg     auca c
     agc       ga     uu         u         gcaug    c 
Get sequence
Deep sequencing
273108 reads, 3.17e+04 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 24675207-24675303 [-]
sense
OTTDART00000028068 ; ctdsp2-001; intron 4
OTTDART00000028070 ; ctdsp2-003; intron 4
ENSDART00000104035 ; ctdsp2-001; intron 4
ENSDART00000137313 ; ctdsp2-003; intron 4
KZ115688.1: 295804-295900 [-]
sense
OTTDART00000028068 ; ctdsp2-001; intron 4
OTTDART00000028070 ; ctdsp2-003; intron 4
ENSDART00000104035 ; ctdsp2-001; intron 4
ENSDART00000137313 ; ctdsp2-003; intron 4
Database links

Mature sequence dre-miR-26b

Accession MIMAT0001795
Sequence

20 - 

uucaaguaauccaggauagguu

 - 41

Get sequence
Deep sequencing273056 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).