Stem-loop sequence dre-mir-26a-3

AccessionMI0001926 (change log)
Previous IDsdre-mir-26a-4
DescriptionDanio rerio miR-26a-3 stem-loop
Gene family MIPF0000043; mir-26
Literature search

9 open access papers mention dre-mir-26a-3
(117 sentences)

Stem-loop
     aag     a  ---g   ca  -gu            ug  u         c          uugug   u 
5' cu   cugau cu    agu  gu   guggcugcaacc  gu caaguaauc aggauaggcu     gac a
   ||   ||||| ||    |||  ||   ||||||||||||  || ||||||||| ||||||||||     |||  
3' ga   gacua ga    uca  ca   caucgacguugg  ca guucauugg ucuuguccgg     uug g
     gaa     -  agaa   -a  aau            gu  c         u          -----   g 
Get sequence
Deep sequencing
276515 reads, 1.65e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr24: 20470954-20471090 [-]
sense
OTTDART00000039206 ; ctdspla-003; exon 1
OTTDART00000039205 ; ctdspla-002; intron 3
OTTDART00000039208 ; ctdspla-005; intron 3
OTTDART00000039204 ; ctdspla-001; intron 4
ENSDART00000132626 ; ctdspla-003; exon 1
ENSDART00000132086 ; ctdspla-002; intron 3
ENSDART00000140651 ; ctdspla-005; intron 3
ENSDART00000089428 ; ctdspla-001; intron 4
ENSDART00000089430 ; ctdspla-201; intron 4
Database links

Mature sequence dre-miR-26a-5p

Accession MIMAT0001794
Previous IDsdre-miR-26a
Sequence

39 - 

uucaaguaauccaggauaggcu

 - 60

Get sequence
Deep sequencing827647 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).