Stem-loop sequence dre-mir-26a-1

AccessionMI0001923 (change log)
DescriptionDanio rerio miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Literature search

9 open access papers mention dre-mir-26a-1
(117 sentences)

Stem-loop
   uuugg     uu     a    a          -g  a 
5'      ccugg  caagu aucc ggauaggcuu  ug u
        |||||  ||||| |||| ||||||||||  || g
3'      ggacu  guuca uagg cuuauccgaa  gc u
   aguaa     ug     g    g          ag  c 
Get sequence
Deep sequencing
277279 reads, 1.65e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 41733533-41733610 [+]
sense
OTTDART00000027578 ; ctdsp1-001; intron 4
ENSDART00000100226 ; ctdsp1-001; intron 4
Database links

Mature sequence dre-miR-26a-5p

Accession MIMAT0001794
Previous IDsdre-miR-26a
Sequence

11 - 

uucaaguaauccaggauaggcu

 - 32

Get sequence
Deep sequencing827647 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-26a-3p

Accession MIMAT0031947
Sequence

49 - 

ccuauucgggaugacuugguuc

 - 70

Get sequence
Deep sequencing359 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).