Stem-loop sequence dre-mir-24-1

AccessionMI0001921 (change log)
DescriptionDanio rerio miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

5 open access papers mention dre-mir-24-1
(78 sentences)

Stem-loop
   -a  uga     g  g   u         ua     u  a 
5'   cc   gcucc gu ccu cugagcuga  ucagu gu g
     ||   ||||| || ||| |||||||||  ||||| || u
3'   gg   ugagg ca gga gacuugacu  gguca ua a
   cc  -ug     a  a   c         -c     c  a 
Get sequence
Deep sequencing
21897 reads, 1.14e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 15960835-15960914 [+]
antisense
OTTDART00000043259 ; si:dkey-3h23.2-002; exon 2
OTTDART00000043258 ; si:dkey-3h23.2-001; exon 3
ENSDART00000142357 ; si:dkey-3h23.2-002; exon 2
ENSDART00000144692 ; si:dkey-3h23.2-001; exon 3
Clustered miRNAs
< 10kb from dre-mir-24-1
dre-mir-23bchr10: 15954579-15954659 [+]
dre-mir-27dchr10: 15954727-15954815 [+]
dre-mir-24-1chr10: 15960835-15960914 [+]
Database links

Mature sequence dre-miR-24

Accession MIMAT0001792
Sequence

49 - 

uggcucaguucagcaggaacag

 - 70

Get sequence
Deep sequencing85524 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).