Stem-loop sequence dre-mir-24-3

AccessionMI0001920 (change log)
DescriptionDanio rerio miR-24-3 stem-loop
Gene family MIPF0000041; mir-24
Literature search

5 open access papers mention dre-mir-24-3
(78 sentences)

Stem-loop
         -   g   --caua  a   aua a    g ug c    c  g   a         uua    acu  g 
5' gcugaa cgg agu      ug gag   g ugga c  g cucc gu ccu cugagcuga   cagu   gu c
   |||||| ||| |||      || |||   | |||| |  | |||| || ||| |||||||||   ||||   ||  
3' cgacuu guc uca      ac cuc   c accu g  c gagg ca gga gacuugacu   guca   ca a
         c   g   caaacc  -   aaa -    - gu u    a  a   c         -cg    ---  a 
Get sequence
Deep sequencing
22199 reads, 1.14e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 30162492-30162633 [-]
sense
OTTDART00000035785 ; zgc:162939-004; intron 5
OTTDART00000035782 ; zgc:162939-002; intron 6
OTTDART00000035783 ; zgc:162939-001; intron 15
ENSDART00000139864 ; C8H9orf3-004; intron 5
ENSDART00000143809 ; C8H9orf3-001; intron 6
ENSDART00000111358 ; C8H9orf3-002; intron 15
KZ115267.1: 347402-347543 [-]
sense
OTTDART00000035785 ; zgc:162939-004; intron 5
OTTDART00000035782 ; zgc:162939-002; intron 6
OTTDART00000035783 ; zgc:162939-001; intron 15
ENSDART00000139864 ; C8H9orf3-004; intron 5
ENSDART00000143809 ; C8H9orf3-001; intron 6
ENSDART00000111358 ; C8H9orf3-002; intron 15
Clustered miRNAs
< 10kb from dre-mir-24-3
dre-mir-23b-2chr8: 30167625-30167708 [-]
dre-mir-27bchr8: 30167435-30167525 [-]
dre-mir-24-3chr8: 30162492-30162633 [-]
Database links

Mature sequence dre-miR-24

Accession MIMAT0001792
Sequence

80 - 

uggcucaguucagcaggaacag

 - 101

Get sequence
Deep sequencing85524 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).